RESEARCH ARTICLE
Detection and Molecular Characterization of Vibrio Parahaemolyticus in Shrimp Samples
Daryoush Asgarpoor1, 2, Fakhri Haghi2, Habib Zeighami 2, *
Article Information
Identifiers and Pagination:
Year: 2018Volume: 12
First Page: 46
Last Page: 50
Publisher ID: TOBIOTJ-12-46
DOI: 10.2174/1874070701812010046
Article History:
Received Date: 25/11/2017Revision Received Date: 30/01/2018
Acceptance Date: 13/3/2018
Electronic publication date: 30/04/2018
Collection year: 2018
open-access license: This is an open access article distributed under the terms of the Creative Commons Attribution 4.0 International Public License (CC-BY 4.0), a copy of which is available at: (https://creativecommons.org/licenses/by/4.0/legalcode). This license permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Abstract
Background:
Food safety has emerged as an important global issue with international trade and public health implications. Bacterial pathogens asVibrio parahaemolyticus recognized as an important cause of foodborne diseases related to the consumption of raw, undercooked or mishandled seafood worldwide.
Methods:
A total of 70 individual wild shrimp samples were collected from shrimp retail outlets in Zanjan, Iran and investigated for the presence of potentially pathogenic strains of V. parahaemolyticus.The shrimp samples were immediately homogenized and cultured on TCBS agarand subjected to confirmatory biochemical tests. Polymerase Chain Reaction (PCR) was performed for detection of total and pathogenic V. parahaemolyticus by amplification of vp–toxR,tdh and trh genes.
Results:
The conventional method indicated that 16 (22.8%) of samples were positive for V. parahaemolyticus. However, PCR verified that only 12 (17.1%) shrimp samples were positive for V. parahaemolyticus. Of the 70 shrimp samples in our study, only 2 (2.8%) tdh and 1 (1.4%) trh positive strains were identified.
Conclusion:
Detection of tdh and/ or trh positive V. parahaemolyticus in shrimp marketed in Zanjan, Iran shows a probable risk for public health. Therefore, the reliable molecular methods for monitoring of potentially pathogenic V. parahaemolyticus are strongly recommended for the routine seafood examination.
1. INTRODUCTION
Vibrio parahaemolyticus is a halophilic marine bacterium and some strains can cause gastroenteritis in humans through the consumption of raw, undercooked or mishandled contaminated seafood [1, 2]. Although the gastroenteritis caused by V. parahaemolyticus is often self–limited and characterized by diarrhea, headache, vomiting, nausea, abdominal cramps and low fever, the infection may cause septicemia, a life-threatening infection, in immunocompromized patients [3-5]. The pathogenic strains of V. parahaemolyticus are characterized by the production of Thermo stable Direct Hemolysin (TDH) and/or TDH–Related Hemolys in (TRH) that can lyse the red blood cells on Wagatsuma blood agar (referred to as the Kanagawa phenomenon) and encoded by tdh and trh genes, respectively [3, 6]. The ubiquitous nature of Vibrio spp. in marine and estuarine environments makes it impossible to obtain seafood completely free of these species. It has been implicated in several outbreaks of seafood poisoning worldwide [6, 7]. Previous epide miological studies showed that V. parahaemolyticus is an important cause of foodborne disease in Asia, South America and the United States. The V. parahaemolyticus is frequently isolated from shellfish including oysters, clams, mussels, lobsters, crabs, shrimps and cockles, which provide an excellent substrate for the growth of these micro organisms in the aquatic habitats [8-13]. Many studies have been carried out on shellfish and findings concerning the distribution of V. parahaemolyticus in oysters and mussels are well documented. However, few data are available forcrustaceans, despite the popularity of crabs and shrimps and their rising consumption worldwide [14]. Shrimp is one of the most important fishery products, and shrimp farming is an important economy characteristic of Iran [13].The frequency of pathogenic V. parahaemolyticus infrozen ready–to–eat shrimps for human consumption was recently studied, and 7 to 8% of samples tested positive for tdh or trh virulence genes in countries such as Malaysia. Therefore, these shrimps might have the potential to cause V. parahaemolyticus–associated infections if consumed without further processing [14].
In recent years, V. parahaemolyticus has been recognized as the causative agent of 50–70% of all cases of gastroenteritis associated with consumption of seafood [5].
There are different methods for detection of V. parahaemolyticus in seafood samples. The most–probable–number (MPN) method is used for enumeration of V. parahaemolyticus from food and water, but this method is cumbersome and the recovery of the organism is low [15].The culture-based approaches and PCR technique which is faster, easier and more sensitive can be used for identification of V. parahaemolyticus in seafood samples [10]. The V. parahaemolyticus strains possess a regulatory gene, toxR, which is present in all strains irrespective of their ability to produce tdh and/or trh.Therefore, the PCR targeted to the toxR gene can be used as a method for identification at the species level [16].
The objective of this study was to determine the frequency of pathogenic V. parahaemolyticus in wild shrimp samples using the culture and PCR methods based on detection of tdh and trh virulence genes in Zanan, Iran.
2. MATERIALS AND METHODS
2.1. Sampling
From March to June 2015, a total of 70 individual wild shrimp samples were collected from shrimp retail outlets in Zanjan, Iran. Shrimp samples were packed into a clean polyethylene bag then marked and transported to the laboratory of food microbiology in a cooler with ice packs for analysis within 1 h.
2.2. Reference Strain
The V. parahaemolyticus ATCC 17802 waskindly obtained from the Pasteur Institute of Iran and was grown on Thiosulphate Citrate Bile Salt Sucrose (TCBS) Agar (MERCK, Darmstadt, Germany).
2.3. Isolation and Identification of V. Parahaemolyticus
The isolation and biochemical identification of V. parahaemolyticus were carried out as recommended in the FDA’s Bacteriological Analytical Manual. Twenty five gram of the samples were homogenized for 60 s in a stomacher (Heidolph, Schwabach, Germany) with 225 mL of alkaline peptone water (APW) containing 3% NaCl and then incubated for enrichment at 37ºC for 24 h. After primary enrichment, a loopful (without shaking the flask) from each of the enriched homogenate was streaked onto the surface of Thiosulfate Citrate Bile Sucrose (TCBS) agar plates (MERCK, Darmstadt, Germany)and incubated at 37°C for 24 h.On TCBS plates, sucrose negative colonies (green or blue-greencolonies with 2–3 mm in diameter), were picked up and inoculated into tryptonesoya broth with 3% NaCl, incubated at 37°C for 24 h, then purified onto nutrient agar slants with 3% NaCl and subjected for confirmatory biochemical tests using different media contained 2.5% NaCl. Every single colony was screened for Gram staining, motility, oxidase and urease activity, NaCl requirement, citrate utilization, triple sugar iron agar, arginine dehydrolase, lysine and ornithine decarboxylase, O/129 sensitivity, vogese proskauer, indole and acid production from lactose, arabinose, cellobiose, mannitol and mannose.
2.4. Genomic DNA Extraction
A colony of V. parahaemolyticus (one colony per sample) was picked from nutrient agar and inoculated into 5 ml of LB (Luria Bertani Broth, Merck) until the exponential phase with 2 McFarland turbidity with shaking at 120 rpm at 37°C. One ml from an overnight culture in LB was spun at 8,000 rpm for 5 min. The supernatant was discarded and the cell pellet was resuspended in 200µL sterile deionized water and boiled at 100ºC for 10 min. The tube was immediately placed in ice for 5 min; then the cell lysate was centrifuged at 13000 r.p.m. for 3 min to pellet the cell debris and the clear supernatant was transferred to a new tube. A 5 µl aliquot of supernatant was used for PCR.
2.5. Molecular Confirmation of V. Parahaemolyticus Isolates
Confirmation of presumptive V. parahaemolyticus isolates was performed using PCR targeting the vp–toxR gene with the following primers and amplicon size 368bp: toxR–F:5'–GTCTTCTGACGCAATCGTTG–3' and toxR–R:5'–ATACGAGTGGTTGCTGTCATG–3' [2]. A specific primer pairs were also used for detection of tdh and trh virulence genes in toxR positive strains with the following sequences: tdh–F:5'–CCACTACCACTCTCATATGC–3' , tdh–R:5'–GGTACTAAATGGCTGACATC–3' with amplicon size 251 bp and trh–F:5'GGCTCAAAATGGTTAAGCG –3' and trh–R:5'–CATTTCCGCTCTCATATGC–3' with amplicon size 250 bp [10]. Single PCR was performed using Dream Taq PCR Master Mix (Thermo Fisher Scientific), which contains Taq polymerase, dNTPs, MgCl2 and the appropriate buffer. Each PCR tube contained 25 µl reaction mixture composed of 12.5 µl of the master mix, 2.5 µl of each forward and reverse primer solution (in a final concentration of 200 nM), 5 µl of DNA and nuclease–free water to complete the final volume. PCR was performed using the Gene Atlas 322 system (ASTEC) with the same cycling conditions for toxR, tdh and trh genes. Amplification involved an initial Denaturation at 94oC, 5 min followed by 30 cycles of denaturation (94oC, 1 min), annealing (57°C, 1.5 min) and extension (72oC, 1.5 min), with a final extension step (72oC, 8 min). The amplified DNA was separated by submarine gel electrophoresis on 1.5% agarose, stained with ethidium bromide and visualized under UV trans illumination.
3. RESULTS AND DISCUSSION
The V. parahaemolyticus is an enteric human pathogen that occurs naturally in the marine and estuarine environments worldwide. Several outbreaks of seafood poisoning were caused by V. parahaemolyticus in many countries and regions of the world including USA, Japan, India and Taiwan [10]. In this study, a total of 70 individual wild shrimp samples were studied for the presence of pathogenic V. parahaemolyticus. A conventional cultural method based on the appearance of green or blue– green colonies on TCBS agar and microscopic examination was detected presumptive V. parahaemolyticus in 30 (42.8%) out of the 70 shrimp samples. However, the biochemical tests of the presumptive V. parahaemolyticus strains indicated that 22.8% (16/70) of shrimp samples were positive for V. parahaemolyticus. Variable incidences of V. parahaemolyticus in seafood had been demonstrated using conventional methods. The frequency of V. parahaemolyticus in our study was lower than some previous studies. According to Abd–Elghany & Sallam [10] and Quintoil et al [17], the frequency of V. parahaemolyticus in shellfish samples was 33.3%, and 36.8%, respectively. However, lower incidence of V. parahaemolyticus in seafood samples was reported from Italy and Netherlands with 6.2%, 24.3% and 8%, respectively [1, 18, 19].
This variation in V. parahaemolyticus frequency among seafood samples may be due to the difference of the geographical region, type of shellfish sample, watersalinity, seasons of sampling, post-harvest practices and hygienic standards applied during the handling, transport and storage of seafood products, as well as the methods used for isolation and identification of the organism [10].
Fast and accurate diagnosis of food–borne pathogens is very important for a positive outcome of eradication programs. PCR based methods which target the conserved region of V. parahaemolyticus such as toxR gene is more efficient, reliable and faster compare to the conventional techniques [20]. In our study, the biochemically identified isolates were further verified using PCR targeting the vp–toxR gene. It has been indicated that 12 (17.1%) samples out of a total 70 shrimp samples were positive for vp–toxR gene. In the present study, the frequency of V. parahaemolyticus positive samples based on vp–toxR gene, was approximately similar to those reported by Abd–Elghany & Sallam in Egypt [10], who found that 16.7% of shellfish samples were positive for vp–toxR gene and also by Hassan et al. [18] in the Netherlands, who detected that 19% (38/200) of retailed shellfish samples were positive for toxR gene. Only a few reports on the frequency of V. parahaemolyticus in seafood samples from Iran have been previously published. According to the previous reports from Iran, 9.3% and 11% of the shrimp samples [13, 21] and 21.4% of the fish samples [22] were positive for the presence of this pathogen.
As the presence of V. Parahaemolyticus strains carrying tdh and/or trh genes in seafood represents a public health risk, their detection would be of paramount importance. It is well known that only 1–2% of the environmental strains possess the tdh gene. Of the 70 shrimp samples in our study, only 2 (2.8%) tdh and 1 (1.4%) trh positive strains were identified. In the previous report from Iran, the prevalence of tdh–positive and trh–positive V. parahaemolyticus was 1.7% and 0.7%, respectively [21]. Similar to our results, in a study conducted in Malaysia, 5 (3.9%) and 1 (0.78%) strains isolated from live and frozen shrimp, respectively were positive for tdh gene, whilst 2 (1.56%) and 1 (0.78%) strains were positive for trh gene [23]. However, higher incidence of virulence V. parahaemolyticus was identified in several studies such as the study conducted in Turkey by Terzi et al. [24] who found that 24 (75%) out of the 32 strains isolated from mussel were potentially pathogenic depending on tdh and trh genes.
CONCLUSION
In conclusion, the detection of tdh and/or trh positive V. parahaemolyticus in shrimp marketed in Zanjan, Iran shows a probable risk for public health. Therefore, intensive and continuous monitoring of potentially pathogenic V. parahaemolyticus are strongly recommended in order to evaluate the human health risk arising from seafood consumption.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Not applicable.
HUMAN AND ANIMAL RIGHTS
No Animals/Humans were used for studies that are base of this research.
CONSENT FOR PUBLICATION
Not applicable.
CONFLICT OF INTEREST
The authors declare no conflict of interest, financial or otherwise.
ACKNOWLEDGEMENTS
This investigation was supported by Student Research Center, Zanjan University of Medical Sciences, Zanjan, Iran (A-12-392-10, ZUMS.REC.1393.265).