Heterologous Expression of Transcription Factor AtWRKY57 Alleviates Salt Stress-Induced Oxidative Damage

All published articles of this journal are available on ScienceDirect.

RESEARCH ARTICLE

Heterologous Expression of Transcription Factor AtWRKY57 Alleviates Salt Stress-Induced Oxidative Damage

Wei Tang, * Open Modal
Authors Info & Affiliations
The Open Biotechnology Journal • 18 Sep 2018 • RESEARCH ARTICLE • DOI: 10.2174/1874070701812010204

Abstract

Background:

WRKY transcription factors play important roles in the responses to abiotic stresses, seed dormancy, seed germination, developmental processes, secondary metabolism, and senescence in plants. However, molecular mechanisms of WRKY transcription factors-related abiotic stress tolerance have not been fully understood.

Methods:

In this investigation, transcription factor AtWRKY57 was introduced into cell lines of rice (Oryza sativa L.), tobacco (Nicotiana tabacum), and white pine (Pinus strobes L.) for characterization of its function in salt stress tolerance. The purpose of this investigation is to examine the function of AtWRKY in a broad sample of plant species including monocotyledons, dicotyledons, and gymnosperms.

Results:

The experimental results demonstrated that heterologous expression of transcription factor AtWRKY57 improves salt stress tolerance by decreasing Thiobarbituric Acid Reactive Substance (TBARS), increasing Ascorbate Peroxidase (APOX) and Catalase (CAT) activity under salt stress. In rice, overexpression of transcription factor AtWRKY57 enhances expression of Ca2+-dependent protein kinase genes OsCPk6 and OsCPk19 to counteract salt stress.

Conclusion:

These results indicated that transcription factor AtWRKY57 might have practical application in genetic engineering of plant salt tolerance throughout the plant kingdom.

Keywords: Abiotic stress, Dicotyledons, Genetic engineering, Gymnosperms, Monocotyledons, Pinus.

1. INTRODUCTION

High salinity is one of the main factors limiting plant growth and crop productivity. The responses of plants to salt stress are an important topic for the biotechnological application plant salt tolerance in the field of abiotic stress. Transcription Factors (TFs) ranging from bZIP, AP2/ERF, NAC, zinc finger proteins, and MYB proteins to WRKY highly influence the efficiency of salt stress-induced gene expression under salt stress. Overexpression of these transcription factors will provide new opportunities for the engineering of plant tolerance to salt stress [1]. In cotton, 42 relevant/related genes were induced by the NaCl treatment and they may be candidate genes as potential markers of tolerance to salt stress [2]. In wheat, transcription factor TaWRKY79 enhanced the level of tolerance to salinity stress via reducing the sensitivity to ABA in the TaWRKY79 transgenic plants, indicating that TaWRKY79 operates in an ABA-dependent pathway [3]. In Triticum aestivum cv. (Yuregir-89), Triticum turgidum cv. (Kiziltan-91), and Triticum monococcum (Siyez), expression analysis of transcription factors TaWLIP19, TaMBF1, TaWRKY10, TaMYB33 and TaNAC69 indicated that all five selected genes in Kiziltan-91 were induced, suggesting that transcription factors might be used for determination of salinity-tolerant for molecular breeding studies [4].

WRKY transcription factors are plant-specific, zinc finger-type transcription factors that are involved in abiotic stress tolerance in a large number of plant species. Analysis of DNA orthology and gene motif compositions indicated that WRKY members in many plant species generally shared the similar motifs. In Gossypium aridum, 28 salt-responsive GarWRKY genes were identified under stress. Overexpression of GarWRKY17 and GarWRKY104 in Arabidopsis demonstrated that these transcription factors would be potential candidates for the genetic improvement of cotton salt stress tolerance [5]. In peanut, transcription factors (NAC, bHLH, WRKY, AP2/ERF) are differentially expressed under salinity stress [6]. In cotton, silencing of C4 (encodes WRKY DNA-binding protein) can significantly enhance cotton susceptibility to salt stress [7]. In foxtail millet (Setaria italica), salt stress-induced methylation in WRKY transcription factor genes and modulates the expression of corresponding genes [8]. In Citrus, a total of 1831 differentially expressed genes were identified and a multitude of transcription factors including WRKY, NAC, MYB, AP2/ERF, bZIP, GATA, bHLH, ZFP, SPL, CBF, and CAMTA was related to cell wall loosening and was also involved in salt stress [9].

Transcription factors could differentially regulate salt stress tolerance. Basic region/leucine zipper (bZIP) transcription factors play key roles in plant growth, development, and stress signaling and perform as crucial regulators in ABA-mediated stress response in plants [10]. In ramie, a bZIP transcription factor BnbZIP2 may act as a positive regulator in response to high-salinity stress [11]. The homeodomain leucine zipper (HD-Zip) transcription factors modulate plant growth and response to environmental stresses. In Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), maize (Zea mays), poplar (Populus trichocarpa), soybean, and cucumber (Cucmis sativus), HD-Zip transcription factors have important roles in dehydration and salt stress [12]. Trihelix transcription factors, which are characterized by containing a conserved trihelix (helix-loop-helix-loop-helix) domain that binds to GT elements, play roles in abiotic stress responses by regulating the expression of stress tolerance genes that result in reduced reactive oxygen species and lipid peroxidation [13]. NAC (NAM ATAF CUC) transcription factors are involved in ethylene-modulated salt tolerance. In apple, MdNAC047 transcription factor was significantly induced by salt treatment and its overexpression conferred increased tolerance to salt stress [14]. WRKY transcription factors appear as important regulators of abiotic stresses tolerance. In tomato, SlWRKY3 binds to the consensus CGTTGACC/T W box and regulates expression of stress-related genes, indicating that SlWRKY3 is an important regulator of salinity tolerance [15]. In Reaumuria trigyna, WRKY transcription factor RtWRKY1 was induced by salt stress and ABA treatment. Overexpression of RtWRKY1 enhanced root length and fresh weight of the transgenic lines under salt stress [16]. In maize, expression of the ZmWRKY17 was up-regulated by salt and ZmWRKY17 acts as a negative regulator involved in the salt stress responses through ABA signaling [17].

NAC transcription factor proteins play important roles in salt stress responses. In Cucumis melo, CmNAC14 regulates expression of salt stress-related genes. Overexpression of CmNAC14 increased the sensitivity of transgenic lines to salt stress [18]. In Chickpea (Cicer arietinum L.), the transcript levels of CarNAC4 were enhanced in response to abiotic stresses. Over-expression of CarNAC4 improved tolerance to salt stresses [19]. In wheat, TaNAC29 was involved in response to salt. TaNAC29 confers salt stress tolerance through reducing H2O2 accumulation by enhancing the antioxidant system [20]. In tomato, SlNAC4-SlNAC10 genes are involved in the response to salt stress [21]. In Arabidopsis thaliana, AtNAC2 is a transcription factor that regulates salt stress and incorporates the environmental and endogenous stimuli into the process of plant lateral root development [22].

WRKY transcription factors play important regulatory roles in plant development and defense response. In Salvia miltiorrhiza, a total of 61 SmWRKYs were cloned [23]. In cucumber, a total of 55 WRKY genes were identified [24]. In Arabidopsis, the expression of AtWRKY25, AtWRKY26, and AtWRKY33 was related to NaCl, and osmotic stress [25]. In canola (Brassica napus L.), 46 WRKY genes were identified to be involved in stress [26]. In rice (Oryza sativa), OsWRKY genes contributing to salt stress tolerance-realted biological processes or signal transduction pathways [27]. In knapweed (Centaurea maculosa), differential gene expression was observed for a putative serpin (CmSER-1) and a calmodulin-like (CmCAL-1) protein. In dandelion (Taraxacum officinale), differential gene expression was observed for a putative protein phosphatase 2C (ToPP2C-1) and cytochrome P-450 (ToCYP-1) protein. These genes are involved in plant stress responses [28]. In Arabidopsis, 49 of the 72 AtWRKY genes were differentially regulated in the plants infected by an avirulent strain of the bacterial pathogen Pseudomonas syringae [29].

Transcription factor WRKY57 is known to function in adaptation to abiotic stresses. In banana (Musa acuminate), WRKY57 is necessary for developing drought-resilient plants [30]. In Arabidopsis, WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2 to allow fine regulation of defense [31]. Overexpression of the Arabidopsis WRKY57 transcription factor AtWRKY57 in rice improved not only drought tolerance but also salt and PEG tolerance, indicating its potential role in crop improvement [32]. In grape (Vitis vinifera L.), the WRKY57-like transcription factor has an important role in some biological processes including cell rescue, protein fate, secondary metabolism, and regulation of transcription [33]. Leaf senescence is regulated by diverse developmental and environmental factors. WRKY57 interacts with the AUX/IAA protein IAA29 to regulate leaf senescence process as a common component of the JA- and auxin-mediated signaling pathways [34]. Constitutive expression of WRKY57 conferred drought tolerance by regulating expression of stress-responsive genes (RD29A, NCED3, and ABA3). ChIP assays demonstrated that WRKY57 could directly bind the W-box of RD29A and NCED3 promoter sequences. Increased WRKY57 expression enhanced drought stress tolerance by increasing ABA levels that will increase drought stress tolerance in plants [35]. In this investigation, we demonstrated that transcription factor AtWRKY57 might have practical application in genetic engineering of plants for salt stress tolerance throughout the plant kingdom.

2. MATERIALS AND METHODS

2.1. Plasmid Constructs

The expression vector pBI121 and the cDNA of WRKY57 were used to construct the pBI-WRKY57 expression vector. Restrict enzymes Kpn I and Xba I (Promega, Madison, WI, USA) were used to digest both the pBI121 vector and the WRKY57 cDNA at 37oC, DNA bands of the pBI121 vector and the WRKY57 cDNA were purified using QIAquick Gel Extraction Kit (QIAGEN, Valencia, CA, USA). The 864-bp fragment of the WRKY57 cDNA was ligated with the DNA of digested pBI121 [36] to produce the expression vector pBI-WRKY57. Vector pBI-WRKY57 was introduced into Agrobacterium tumefaciens strain LBA4404 by electroporation.

2.2. Agrobacterium-Mediated Transformation

Transgenic cell lines of rice (Oryza sativa L.), tobacco (Nicotiana tabacum), and white pine (Pinus strobes L.) were prepared as previously described [37, 38], using Agrobacterium tumefaciens strain LBA4404 carrying pBI-WRKY57 to transform cell cultures. Transgenic cells of rice, tobacco, and white pine were sub-cultured on a liquid proliferation medium for six weeks to obtain large quantities of cell cultures for further analysis. After 6 weeks, 50-70 mg of tissue/l cultures can be produced each week, and they were then used molecular analysis including PCR, Southern blot analysis, and northern blotting analysis.

2.3. Polymerase Chain Reaction and Southern Blot Analyses of Transgenic Cultures

Polymerase Chain Reaction (PCR) and Southern blotting analysis of putative transgenic cell lines of rice, tobacco, and white pine were conducted as previously described [37, 38]. 500 mg fresh cells of rice, tobacco, and white pine control and putative transgenic cell lines were used to isolate genomic DNA, using a Genomic DNA Isolation Kit (Sigma) following the manufacturer’s protocol. PCR was done in a PTC-100TM Programmable Thermal Controller (MJ Research, San Francisco, CA, USA). The primers used are the nptII forward primer (nfp) 50-ACAAACAGACAATCGGCTGC-30 and the reverse primer (nrp) 50-AAGAACTCGTCAAGAAGGCG-30, as well as the transcription factor WRKY57 forward primer (zfp) 5’-ATGAACGATCCTGATAATCCCGATC-3’ the reverse primer (zrp) 5’-TCAAGGGTTGCGCATAGTTTGAGG-3’ were used. Southern blot analysis was conducted as previously described [38]. 25 μg DNA was digested overnight at 37 oC. Probes (864 pb fragment of WRKY57) were labeled by Digoxigenin (DIG) (Roche Diagnostics, Indianapolis, IN, USA).

2.4. RNA Isolation and Northern Blot Analysis

Total RNA was isolated from 5 g fresh cell cultures of rice, tobacco, and white pine control and putative transgenic cell lines, respectively, using a RNeasy Mini Plant Kit (Germantown, MD, USA) following the manufacturer’s protocol. Then, 6 μg RNA from rice, tobacco, and white pine transgenic cells were separated by agarose-gel electrophoresis. Electrophoresis and northern blotting of RNAs were performed as previously described [36]. Digoxigenin (DIG)-labelling WRKY57 DNA (864 pb) (Roche Diagnostics) was used as a hybridization probe. Equal loading of RNA samples of rice, tobacco, and white pine was verified on the control of tobacco 25SrRNA. After PCR, Southern blotting and northern blotting analyses, four cell lines each containing one copy of the pBI-WRKY57 T-DNA were selected from rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, andNt6), and white pine (Ps1, Ps2, Ps3, and Ps4) and used for salt-induced oxidative damage experiments.

2.5. Salt Treatment of Transgenic Cell Lines

Salt treatment was applied by adding different concentrations of NaCl (50, 100, 150, 200, 250, and 300 mM) to the media used for transgenic cell cultures, which consisted of TE medium [38] containing 0.5 μM indole-3-butyric acid, 8.9 μM BA. The effects of NaCl on growth of cell cultures of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, andNt6), and white pine (Ps1, Ps2, Ps3, and Ps4) were examined by culture of cell cultures on growth medium containing different concentrations of NaCl, as previously described [36-38]. The average growth was expressed as mg/g FW/day.

2.6. Thiobarbituric Acid Reactive Substances (TBARS) Determination

The amount of thiobarbituric acid reactive substances (TBARS) was determined using the method of thiobarbituric acid (TBA) reaction as described previously [38]. Cell cultures (1 g) of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, andNt6), and white pine (Ps1, Ps2, Ps3, and Ps4) were homogenized in 3 ml of 20% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 5,000 rpm for 20 min and mixed with 20% TCA containing 0.5% (w/v) TBA and100 ll 4% BHT in ethanol at 1:1. The amount of thiobarbituric acid reactive substances was determined using the method previously described [36].

2.7. Antioxidant Enzymes Ascorbate Peroxidase (APOX) and Catalase (CAT) Activity Determination

Determination of activities of APOX and CAT were determined as described previously [36-38]. Two grams of non-transgenic control and transgenic cell cultures of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, andNt6), and white pine (Ps1, Ps2, Ps3, and Ps4) were homogenized under ice-cold conditions in 3 ml of extraction buffer, containing 50 mM phosphate buffer (pH 7.4), 1 mM EDTA, 1 g PVP, and 0.5% (v/v) Triton X-100 at 4 oC [36-38]. The homogenates were centrifuged at 10,000 × g for 20 min and the supernatant fraction was used for the assays. APOX activity was measured immediately in fresh extracts and was assayed as described [36]. CAT activity was detected in a 3 ml 50 mMpotassium phosphate buffer (pH 7.8) containing 3 mMH2O2, as previously described [36].

2.8. Expression Analysis of OsCPK Genes

Expression of OsCPK6 and OsCPK19 was analyzed by northern blotting by the method described previously [37, 38]. Twenty micrograms of total RNA of rice (Os1, Os2, Os3, and Os4) was used. The PCR-amplified fragments of OsCPK6 (amplified by forward primer 5’- atgggcaactactactcgtg -3’ and reverse primer 5’- acgtacaggttgtcctcgt -3’) and OsCPK19 (amplified by forward primer 5’- ggagcaaacggttatggcta -3’ and reverse primer 5’- gcgcttagagatggatttgc -3’) were labeled by Digoxigenin (DIG) (Roche Diagnostics Corporation, Roche Applied Science, Indianapolis, IN, USA) and were used as a hybridization probe [37, 38].

2.9. Statistical Analyses

Data on growth rate, amount of TBARS, APOX and CAT activity, amount of OsCPK6 and OsCPK19 obtained from different experiments were analyzed in Graphpad Prism 6 software. The significant differences between mean values derived from three independent biological experiments were determined using the least significant difference test at 5% level of probability.

3. RESULTS

3.1. Molecular Analyses of Transgenic Cell Lines

Transgenic cell lines of rice (Oryza sativa L.), tobacco (Nicotiana tabacum), and white pine (Pinus strobes L.) were obtained through Agrobacterium tumefaciens-mediated transformation and were examined by PCR, Southern blotting, and northern blotting (Fig. 1). A total of 109 transgenic cell lines including 31 cell line from rice, 36 cell line from tobacco, and 42 cell line from white pine, were obtained after PCR analysis using primers for neomycin phosphotransferase II gene and primer for WRKY57. After confirmation by PCR, four cell lines were randomly selected and used for further analysis. The presence of the 717-bp band amplified by primers nrp and nfp from templates obtained from transgenic cells and absence of the 717-bp band amplified by primers nrp and nfp indicate that the T-DNA (Fig. 1A) is integrated into the genome. This is further confirmed by PCR using primers for WRKy57 that the 864-bp band amplified by primers zf and zr from templates obtained from transgenic cells and absence of the 864-bp band amplified by primers zf and zr (Fig. 1B). Integration of T-DNA into the genome of rice, tobacco, and white pine was also confirmed by Southern and northern blotting analisys (Figs. 1C, D).

Fig. (1). Plasmid map and molecular analyses of transgenic cell lines. (A) A linear plasmid map. (B) PCR analysis of WRKY57 transgenic cell lines. (C) Southern blot analysis of WRKY57 transgenic cell lines. (D) Northern blot analysis of WRKY57 transgenic cell lines.

3.2. Growth of Cell Lines Under Different Concentrations of NaCL

Growth rate (Fig. 2) of transgenic cell lines of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, and Nt4), and white pine (Ps1, Ps2, Ps3, and Ps4) were measured 3 days after transgenic cell cultures were transferred into media containing different concentrations of NaCl (50, 100, 150, 200, 250, and 300 mM). The medium containing no NaCl was used as the control of salt stress. A significant difference in growth rate was obtained when transgenic cell cultures were cultured on media containing 150, 200, 250, or 300 mM NaCl, compared to the control. Similar results were obtained in all 12 transgenic cell lines derived from rice, tobacco, and white pine, indicating that overexpression of WRKY57 enhances salt stress tolerance in plants including monocotyledons (rice, Fig. 2A), dicotyledons (tobacco, Fig. 2B), and gymnosperms (white pine, Fig. 2C).

Fig. (2). Growth of cell lines under different concentrations of NaCl. (A-C) Effect of different concentrations of NaCl (50, 100, 150, 200, 250, and 300 mM) on the growth of transgenic cell lines of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, and Nt4), and white pine (Ps1, Ps2, Ps3, and Ps4) were measured 3 days after callus transgenic cell cultures were transferred into media containing NaCl. Each experiment was replicated three times, and each replicate consisted of five to ten 250-ml flasks of transgenic cell cultures. Values represent the means ± S.D.

3.3. Thiobarbituric Acid Reactive Substance (TBARS) Changes Under Different Concentrations of NaCl

The salt stress increased the formation of lipid peroxidation via increasing the rate of Reactive Oxygen Species (ROS) formation. Decreasing lipid peroxidation via genetic engineering approaches in cells will increases cells tolerance to salt stress. To determine if salt stress tolerance enhanced by overexpression of WRKY57 is related to the change of Thiobarbituric Acid Reactive Substance (TBARS), TBARS was measured in transgenic cell lines of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, and Nt4), and white pine (Ps1, Ps2, Ps3, and Ps4) 3 days after cell cultures were transferred into media containing different concentrations of NaCl (Fig. 3). A significant decrease in the amount of TBARS was obtained in rice (Fig. 3A), tobacco (Fig. 3B), and white pine (Fig. 3C) when transgenic cell cultures were cultured on media containing 150, 200, 250, or 300 mM NaCl, compared to the control. Similar results were obtained in all 12 transgenic cell lines derived from rice, tobacco, and white pine, indicating that overexpression of WRKY57 enhances salt stress tolerance by decreasing the amount of TBARS. Compared to the control, no significant decrease in the amount of TBARS was obtained when 50 mM and 100 mM NaCl were applied to the transgenic cells.

Fig. (3). Thiobarbituric acid reactive substance (TBARS) changes under different concentrations of NaCl. (A-C) TBARS changes in transgenic cell lines of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, and Nt4), and white pine (Ps1, Ps2, Ps3, and Ps4). The TBARS were measured 3 days after cell cultures were transferred into media containing different concentrations of NaCl (50, 100, 150, 200, 250, and 300 mM). Each experiment was replicated three times, and each replicate consisted of five to ten 250-ml flasks of transgenic cell cultures. Values represent the means ± S.D.

3.4. Effect of WRKY57 Overexpression on APOX and CAT Activity

To examine if salt stress tolerance enhanced by overexpression of WRKY57 is involved in the change of antioxidant enzymes Ascorbate Peroxidase (APOX) and Catalase (CAT) activity, APOX and CAT activity were measured in transgenic cell lines of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, and Nt4), and white pine (Ps1, Ps2, Ps3, and Ps4) 3 days after cell cultures were transferred into media containing different concentrations of NaCl (Fig. 4A). Increased APOX and CAT activity were observed in transgenic cell lines of rice (Figs. 4A, D), tobacco (Figs. 4E, 4F) and white pine (Figs. 4C, F) indicating that overexpression of WRKY57 enhances salt stress tolerance by increasing the activity of APOX and CAT. Compared to the control, no significant increase in APOX and CAT activity was obtained when 50 mM and 100 mM NaCl were applied to the transgenic cells.

Fig. (4). Effect of WRKY57 overexpression on APOX and CAT activity. APOX and CAT activity changes in transgenic cell lines of rice (Os1, Os2, Os3, and Os4), tobacco (Nt1, Nt2, Nt3, and Nt4), and white pine (Ps1, Ps2, Ps3, and Ps4) were measured 3 days after cell cultures were transferred into media containing different concentrations of NaCl (50, 100, 150, 200, 250, and 300 mM). Each experiment was replicated three times, and each replicate consisted of five to ten 250-ml flasks of transgenic cell cultures. Values represent the means ± S.D.

3.5. Influence of NaCl on Expression of Rice Ca2+-Dependent Protein Kinase Gene Oscpk6 and Oscpk19

To investigate if salt stress tolerance enhanced by overexpression of WRKY57 is related to the expression of Ca2+-dependent protein kinase gene OsCPK6, the amount of OsCPK6 mRNA was measured by northern blotting in transgenic cell lines of rice (Os1, Os2, Os3, and Os4), 24, 48, and 96 hours after cell cultures were transferred into media containing 250 mM NaCl (Fig. 5). Increase in the amount of OsCPK6 mRNA was obtained in rice 24, 48, and 96 hours after transgenic cell cultures were treated by 250 mM NaCl in all four rice cell lines Quantitative analysis of expression of Ca2+- dependent protein kinase gene OsCPK9 demonstrated that the amount of OsCPK6 mRNA was increased significantly (Figs. 5B, E), compared to the control. Northern blotting analysis of expression of Ca2+- dependent protein kinase gene OsCPK19 (Fig. 6) in WRKY57 transgenic cell lines Os1, Os2, Os3, and Os4 demonstrated that the amount of OsCPK19 mRNA was increased under 250 mM NaCl treatment at 24, 48, and 96 h. Quantitative analysis of the expression of Ca2+- dependent protein kinase gene OsCPK9 demonstrated that the amount of OsCPK19 mRNA was increased significantly (Figs. 6B, E).

Fig. (5). OsCPK6 expression in rice cells under NaCl stress. (A) OsCPK6 expression in WRKY57 transgenic cells. (B-E) Quantification of OsCPK6 expression. Each experiment was replicated three times. Values represent the mean ± SD.

4. DISCUSSION

The WRKY transcription factors play very important roles in plant growth, some development stages, and plants responses to abiotic stresses. In Sesame (Sesamum indicum L.), manipulating WRKYs could improve resistance to waterlogging stress and drought stress [39]. In Arabidopsis, WRKY75 functions as a new component of the GA-mediated signaling pathway to positively regulate flowering in Arabidopsis [40]. WRKY71 activity hastens flowering by providing a means for the plant to complete its life cycle in the presence of salt stress [41]. WRKY36 is a negative regulator of HY5 and UVB represses WRKY36 via UVR8 to promote the transcription of HY5 and photomorphogenesis [42]. In oilseed rape (Brassica napus), BnWRKY15 overexpression simultaneously increased the susceptibility of B. napus to S. sclerotiorum and down-regulated BnWRKY33 after different durations of infection [43]. AtWRKY11 and AtWRKY17 are not strictly limited to plant defense responses but are also involved in conferring stress tolerance [44]. Overexpression of WRKY27 displays significantly decreased pollen viability ans is involved in proper plant biomass accumulation and male fertility [45]. In Arabidopsis, WRKY43 acts as a potent modulator of fatty acid desaturation and seed filling, which results in increased tolerance to abiotic stress [46]. WRKY46, WRKY54, and WRKY70, are involved in both BR-regulated plant growth and drought response [47]. Transcription factor WRKY57 enhances salt stress tolerances in plant [32] and is important for developing drought-resilient crops [30]. In grape (Vitis vinifera L.), the WRKY57-like protein was strongly upregulated by UV-C irradiation and have great implications for further studies [33-35].

Environmental stress can affect the viability of an organism and may affect the genome or the proteome by contributing to protein damage or misfolding [48-52]. Plant responses to abiotic stress require two protective measures, one is to reduce stress-inflicted damage to cellular structures, another is the molecular mechanism that efficiently removes damaged and toxic macromolecules [53]. The antioxidant enzyme activities (Superoxide Dismutase (SOD), Ascorbate Peroxidase (APX), and Glutathione Reductase (GR)) and the contents of malondialdehyde (MDA) and H2O2 are important in reactive oxygen scavenging systems that could enhance salinity tolerance and alleviated salinity-induced damage in plants [54]. The Ca2+- dependent protein kinase gene OsCPK4 gene is a member of the complex gene family of calcium-dependent protein kinases in rice (Oryza sativa). OsCPK4 is a positive regulator of the salt and drought stress responses in rice that protect cellular membranes and cell signaling transduction from stress-induced oxidative damage [55].

Fig. (6). OsCPK19 expression in rice cells under NaCl stress. (A) OsCPK19 expression in WRKY57 transgenic cells. (B-E) Quantification of OsCPK19 expression. Each experiment was replicated three times. Values represent the mean ± SD.

Inorganic Nanoparticles (NP) have been used in different applications and recent research demonstrated that NP cause adverse effects via induction of an oxidative stress. In vitro methods using oxidative stress biomarkers to measure stress were designed and standardized for conventional NP [56]. It has been reported that a melon Superoxide Dismutase (SODB) is involved in oxidative stress. SODB could exert its antioxidant properties by inducing the endogenous antioxidant defense [57]. OsCEST and AtCEST were mainly transcribed in photosynthetic tissues. Overexpression of CEST enhanced tolerance not only to salt stress but also to drought stress, and high-temperature stress, which causes photooxidative stress [58]. In potato (Solanum tuberosum L. cv. Taedong Valley), a higher level of GSH homeostasis and higher glyoxalase activity inhibit the accumulation of methylglyoxal under salt stress [59]. Investigation of exogenous selenium (Se) in the antioxidant defense demonstrated that exogenous selenium improves stress tolerant to salt stress-induced oxidative damage and enhances their antioxidant defense and MG detoxification systems [60].

Salinity stress-induced production of Reactive Oxygen Species (ROS) and associated oxidative damage is one of the major factors limiting crop production in saline soils [61]. Superoxide Dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and glutathione reductase in chickpea plants were up-regulated by salt stress [52]. Transcription factors, such as MYB, WRKY, and zinc finger transcription factors may be regulated by environmental stresses, such as hormones, drought, cold, heat, and pathogens as well as by Pi starvation [62-64]. In tomato, high-antioxidant enzyme activities were induced during the response to salt stress [63]. Intricate signaling network responding to the diverse environmental stress could be developed by plants. The transcript expression of SA biosynthetic gene ICS1 and CAT and SOD antioxidative enzymes demonstrated upregulation during stress, indicating biochemical and molecular pathways to maneuver salt stress tolerance of the transgenic plants [64-70].

CONCLUSION

In this investigation, transcription factor AtWRKY57 was introduced into cell lines of rice (Oryza sativa L.), tobacco (Nicotiana tabacum), and white pine (Pinus strobes L.) for characterization of its function in salt stress tolerance. The purpose of this investigation is to examine the function of AtWRKY throughout the plant kingdom including monocotyledons, dicotyledons, and gymnosperms. The experimental results demonstrated that heterologous expression of transcription factor AtWRKY57 improves salt stress tolerance by decreasing Thiobarbituric Acid Reactive Substance (TBARS), increasing Ascorbate Peroxidase (APOX) and Catalase (CAT) activity under salt stress. In rice, overexpression of transcription factor AtWRKY57 enhances expression of Ca2+-dependent protein kinase genes OsCPk6 and OsCPk19 to counteract salt stress. These results indicated that transcription factor AtWRKY57 might have practical application in genetic engineering of plant salt tolerance throughout the plant kingdom.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

Not applicable.

HUMAN AND ANIMAL RIGHTS

No Animals/Humans were used for studies that are base of this research.

CONSENT FOR PUBLICATION

Not applicable.

CONFLICT OF INTEREST

The author declares no conflict of interest, financial or otherwise.

ACKNOWLEDGEMENTS

The author is grateful to Wells Thompson and Jennifer Whitley for their critical reading of the manuscript. The author appreciates Nicole Franco-Zorrilla, Tinya Backiyarani, and Ambrosia Oluwadahunsi for their support in preparing transgenic cell cultures. This work was supported by a grant from the Education Committee of Hubei Providence of China (Grant No. D20101306).

REFERENCES

1
Golldack D, Lüking I, Yang O. Plant tolerance to drought and salinity: Stress regulating transcription factors and their functional significance in the cellular transcriptional network. Plant Cell Rep 2011; 30(8): 1383-91.
2
Yao D, Zhang X, Zhao X, et al. Transcriptome analysis reveals salt-stress-regulated biological processes and key pathways in roots of cotton (Gossypium hirsutum L.). Genomics 2011; 98(1): 47-55.
3
Qin Y, Tian Y, Han L, Yang X. Constitutive expression of a salinity-induced wheat WRKY transcription factor enhances salinity and ionic stress tolerance in transgenic Arabidopsis thaliana. Biochem Biophys Res Commun 2013; 441(2): 476-81.
4
Baloglu MC, Inal B, Kavas M, Unver T. Diverse expression pattern of wheat transcription factors against abiotic stresses in wheat species. Gene 2014; 550(1): 117-22.
5
Fan X, Guo Q, Xu P, et al. Transcriptome-wide identification of salt-responsive members of the WRKY gene family in Gossypium aridum. PLoS One 2015; 10(5): e0126148.
6
Sui J, Jiang D, Zhang D, et al. The salinity responsive mechanism of a hydroxyproline-tolerant mutant of peanut based on digital gene expression profiling analysis. PLoS One 2016; 11(9): e0162556.
7
Cai C, Wu S, Niu E, Cheng C, Guo W. Identification of genes related to salt stress tolerance using intron-length polymorphic markers, association mapping and virus-induced gene silencing in cotton. Sci Rep 2017; 7(1): 528.
8
Pandey G, Yadav CB, Sahu PP, Muthamilarasan M, Prasad M. Salinity induced differential methylation patterns in contrasting cultivars of foxtail millet (Setaria italica L.). Plant Cell Rep 2017; 36(5): 759-72.
9
Xie R, Pan X, Zhang J, et al. Effect of salt-stress on gene expression in citrus roots revealed by RNA-seq. Funct Integr Genomics 2018; 18(2): 155-73.
10
Zhu M, Meng X, Cai J, Li G, Dong T, Li Z. Basic leucine zipper transcription factor SlbZIP1 mediates salt and drought stress tolerance in tomato. BMC Plant Biol 2018; 18(1): 83.
11
Huang C, Zhou J, Jie Y, et al. A ramie bZIP transcription factor bnbzip2 is involved in drought, salt, and heavy metal stress response. DNA Cell Biol 2016; 35(12): 776-86.
12
Belamkar V, Weeks NT, Bharti AK, Farmer AD, Graham MA, Cannon SB. Comprehensive characterization and RNA-Seq profiling of the HD-Zip transcription factor family in soybean (glycine max) during dehydration and salt stress. BMC Genomics 2014; 15: 950.
13
Xu H, Shi X, He L, et al. Arabidopsis thaliana trihelix transcription factor AST1 mediates salt and osmotic stress tolerance by binding to a novel agag-box and some gt motifs. Plant Cell Physiol 2018; 59(5): 946-65.
14
An JP, Yao JF, Xu RR, You CX, Wang XF, Hao YJ. An apple NAC transcription factor enhances salt stress tolerance by modulating the ethylene response. Physiol Plant 2018.
15
Hichri I, Muhovski Y, Žižková E, et al. The Solanum lycopersicum WRKY3 transcription factor slwrky3 is involved in salt stress tolerance in tomato. Front Plant Sci 2017; 8: 1343.
16
Du C, Zhao P, Zhang H, Li N, Zheng L, Wang Y. The reaumuria trigyna transcription factor RtWRKY1 confers tolerance to salt stress in transgenic Arabidopsis. J Plant Physiol 2017; 215: 48-58.
17
Cai R, Dai W, Zhang C, et al. The maize WRKY transcription factor ZmWRKY17 negatively regulates salt stress tolerance in transgenic arabidopsis plants. Planta 2017; 246(6): 1215-31.
18
Wei S, Gao L, Zhang Y, Zhang F, Yang X, Huang D. Genome-wide investigation of the NAC transcription factor family in melon (Cucumis melo L.) and their expression analysis under salt stress. Plant Cell Rep 2016; 35(9): 1827-39.
19
Yu X, Liu Y, Wang S, et al. CarNAC4, a NAC-type chickpea transcription factor conferring enhanced drought and salt stress tolerances in Arabidopsis. Plant Cell Rep 2016; 35(3): 613-27.
20
Xu Z, Gongbuzhaxi C, Wang C, Xue F, Zhang H, Ji W. Wheat NAC transcription factor TaNAC29 is involved in response to salt stress. Plant Physiol Biochem 2015; 96: 356-63.
21
Zhu M, Chen G, Zhang J, et al. The abiotic stress-responsive NAC-type transcription factor SlNAC4 regulates salt and drought tolerance and stress-related genes in tomato (Solanum lycopersicum). Plant Cell Rep 2014; 33(11): 1851-63.
22
He XJ, Mu RL, Cao WH, Zhang ZG, Zhang JS, Chen SY. AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. The Plant Journal: For cell and molecular biology 2005; 44(11): 903-16.
23
Li C, Li D, Shao F, Lu S. Molecular cloning and expression analysis of WRKY transcription factor genes in Salvia miltiorrhiza. BMC Genomics 2015; 16: 200.
24
Ling J, Jiang W, Zhang Y, et al. Genome-wide analysis of WRKY gene family in Cucumis sativus. BMC Genomics 2011; 12: 471.
25
Fu QT, Yu DQ. Expression profiles of atWRKY25, atWRKY26 and atWRKY33 under abiotic stresses. Yi chuan = Hereditas 2010; 32: 848-56.
26
Yang B, Jiang Y, Rahman MH, Deyholos MK, Kav NN. Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments. BMC Plant Biol 2009; 9: 68.
27
Berri S, Abbruscato P, Faivre-Rampant O, et al. Characterization of WRKY co-regulatory networks in rice and Arabidopsis. BMC Plant Biol 2009; 9: 120.
28
Keates SE, Kostman TA, Anderson JD, Bailey BA. Altered gene expression in three plant species in response to treatment with Nep1, a fungal protein that causes necrosis. Plant Physiol 2003; 132(3): 1610-22.
29
Dong J, Chen C, Chen Z. Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol Biol 2003; 51(1): 21-37.
30
Muthusamy M, Uma S, Backiyarani S, Saraswathi MS, Chandrasekar A. Transcriptomic changes of drought-tolerant and sensitive banana cultivars exposed to drought stress. Front Plant Sci 2016; 7: 1609.
31
Jiang Y, Yu D. The WRKY57 transcription factor affects the expression of jasmonate zim-domain genes transcriptionally to compromise botrytis cinerea resistance. Plant Physiol 2016; 171(4): 2771-82.
32
Jiang Y, Qiu Y, Hu Y, Yu D. Heterologous expression of AtWRKY57 confers drought tolerance in Oryza sativa. Front Plant Sci 2016; 7: 145.
33
Xi H, Ma L, Liu G, et al. Transcriptomic analysis of grape (Vitis vinifera L.) leaves after exposure to ultraviolet C irradiation. PLoS One 2014; 9(12): e113772.
34
Jiang Y, Liang G, Yang S, Yu D. Arabidopsis WRKY57 functions as a node of convergence for jasmonic acid- and auxin-mediated signaling in jasmonic acid-induced leaf senescence. Plant Cell 2014; 26(1): 230-45.
35
Jiang Y, Liang G, Yu D. Activated expression of WRKY57 confers drought tolerance in arabidopsis. Mol Plant 2012; 5(6): 1375-88.
36
Tang W, Page M, Fei Y, et al. Overexpression of atbZIP60deltaC gene alleviates salt induced oxidative damage in transgenic cell cultures. Plant Mol Biol Report 2012; 30: 1183-95.
37
Tang W, Fei Y, Page M. Elevated tolerance to salt stress in transgenic cells expressing transcription factor AtbZIP60 is associated with the increased activities of H+ATPase and acid phosphatase. Plant Biotechnol Rep 2012; 6: 313-25.
38
Tang W, Page M. Overexpression of the Arabidopsis AtEm6 gene enhances salt tolerance in transgenic rice cell lines. Plant Cell Tissue Organ Cult 2013; 114: 339-50. [PCTOC].
39
Wei W, Hu Y, Han YT, Zhang K, Zhao FL, Feng JY. The WRKY transcription factors in the diploid woodland strawberry Fragaria vesca: Identification and expression analysis under biotic and abiotic stresses. Plant Physiol Biochem 2016; 105: 129-44.
40
Zhang L, Chen L, Yu D. Transcription factor WRKY75 interacts with DELLA proteins to affect flowering. Plant Physiol 2018; 176(1): 790-803.
41
Yu Y, Wang L, Chen J, Liu Z, Park CM, Xiang F. WRKY71 acts antagonistically against salt-delayed flowering in Arabidopsis thaliana. Plant Cell Physiol 2018; 59(2): 414-22.
42
Yang Y, Liang T, Zhang L, et al. UVR8 interacts with WRKY36 to regulate HY5 transcription and hypocotyl elongation in Arabidopsis. Nat Plants 2018; 4(2): 98-107.
43
Liu F, Li X, Wang M, et al. Interactions of WRKY15 and WRKY33 transcription factors and their roles in the resistance of oilseed rape to Sclerotinia infection. Plant Biotechnol J 2018; 16(4): 911-25.
44
Ali MA, Azeem F, Nawaz MA, et al. Transcription factors WRKY11 and WRKY17 are involved in abiotic stress responses in arabidopsis. J Plant Physiol 2018; 226: 12-21.
45
Mukhtar MS, Liu X, Somssich IE. Elucidating the role of WRKY27 in male sterility in arabidopsis. Plant Signal Behav 2017; 12(9): e1363945.
46
Geilen K, Heilmann M, Hillmer S, Böhmer M. WRKY43 regulates polyunsaturated fatty acid content and seed germination under unfavourable growth conditions. Sci Rep 2017; 7(1): 14235.
47
Chen J, Nolan TM, Ye H, et al. Arabidopsis WRKY46, WRKY54, and WRKY70 transcription factors are involved in brassinosteroid-regulated plant growth and drought responses. Plant Cell 2017; 29(6): 1425-39.
48
Sampuda KM, Riley M, Boyd L. Stress induced nuclear granules form in response to accumulation of misfolded proteins in caenorhabditis elegans. BMC Cell Biol 2017; 18(1): 18.
49
Abolaji AO, Olaiya CO, Oluwadahunsi OJ, Farombi EO. Dietary consumption of monosodium L-glutamate induces adaptive response and reduction in the life span of Drosophila melanogaster. Cell Biochem Funct 2017; 35(3): 164-70.
50
Ranjit SL, Manish P, Penna S. Early osmotic, antioxidant, ionic, and redox responses to salinity in leaves and roots of Indian mustard (Brassica juncea L.). Protoplasma 2016; 253(1): 101-10.
51
Penella C, Landi M, Guidi L, et al. Salt-tolerant rootstock increases yield of pepper under salinity through maintenance of photosynthetic performance and sinks strength. J Plant Physiol 2016; 193: 1-11.
52
Ahmad P, Abdel Latef AA, Hashem A, Abd Allah EF, Gucel S, Tran LS. Nitric oxide mitigates salt stress by regulating levels of osmolytes and antioxidant enzymes in chickpea. Front Plant Sci 2016; 7: 347.
53
Zhou J, Zhang Y, Qi J, et al. E3 ubiquitin ligase CHIP and NBR1-mediated selective autophagy protect additively against proteotoxicity in plant stress responses. PLoS Genet 2014; 10(1): e1004116.
54
Wang R, Liu S, Zhou F, Ding C, Hua C. Exogenous ascorbic acid and glutathione alleviate oxidative stress induced by salt stress in the chloroplasts of oryza sativa L. Z Natforsch C J Biosci 2014; 69(5-6): 226-36.
55
Campo S, Baldrich P, Messeguer J, Lalanne E, Coca M, San Segundo B. Overexpression of a calcium-dependent protein kinase confers salt and drought tolerance in rice by preventing membrane lipid peroxidation. Plant Physiol 2014; 165(2): 688-704.
56
Tournebize J, Sapin-Minet A, Bartosz G, Leroy P, Boudier A. Pitfalls of assays devoted to evaluation of oxidative stress induced by inorganic nanoparticles. Talanta 2013; 116: 753-63.
57
Carillon J, Romain C, Bardy G, et al. Cafeteria diet induces obesity and insulin resistance associated with oxidative stress but not with inflammation: Improvement by dietary supplementation with a melon superoxide dismutase. Free Radic Biol Med 2013; 65: 254-61.
58
Yokotani N, Higuchi M, Kondou Y, et al. A novel chloroplast protein, CEST induces tolerance to multiple environmental stresses and reduces photooxidative damage in transgenic Arabidopsis. J Exp Bot 2011; 62(2): 557-69.
59
Upadhyaya CP, Venkatesh J, Gururani MA, et al. Transgenic potato overproducing L-ascorbic acid resisted an increase in methylglyoxal under salinity stress via maintaining higher reduced glutathione level and glyoxalase enzyme activity. Biotechnol Lett 2011; 33(11): 2297-307.
60
Hasanuzzaman M, Hossain MA, Fujita M. Selenium-induced up-regulation of the antioxidant defense and methylglyoxal detoxification system reduces salinity-induced damage in rapeseed seedlings. Biol Trace Elem Res 2011; 143(3): 1704-21.
61
Wang H, Shabala L, Zhou M, Shabala S. Hydrogen peroxide-induced root Ca2+ and K+ fluxes correlate with salt tolerance in cereals: Towards the cell-based phenotyping. Int J Mol Sci 2018; 19(3): 19.
62
Baek D, Chun HJ, Yun DJ, Kim MC. Cross-talk between phosphate starvation and other environmental stress signaling pathways in plants. Mol Cells 2017; 40(10): 697-705.
63
Gharsallah C, Fakhfakh H, Grubb D, Gorsane F. Effect of salt stress on ion concentration, proline content, antioxidant enzyme activities and gene expression in tomato cultivars. AoB Plants 2016; 8: 8.
64
Agarwal P, Dabi M, Sapara KK, Joshi PS, Agarwal PK. Ectopic expression of jcwrky transcription factor confers salinity tolerance via salicylic acid signaling. Front Plant Sci 2016; 7: 1541.
65
Tang W, Page M. Transcription factor AtbZIP60 regulates expression of Ca2+ -dependent protein kinase genes in transgenic cells. Mol Biol Rep 2013; 40(3): 2723-32.
66
Tang W, Newton RJ, Weidner DA. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine. J Exp Bot 2007; 58(3): 545-54.
67
Tang W, Weidner DA, Hu BY, Newton RJ, Hu XH. Efficient delivery of small interfering RNA to plant cells by a nanosecond pulsed laser-induced stress wave for posttranscriptional gene silencing. Plant science: An international journal of experimental plant biology 2006; 171: 375-81.
68
Tang W, Newton RJ, Lin J, Charles TM. Expression of a transcription factor from Capsicum annuum in pine calli counteracts the inhibitory effects of salt stress on adventitious shoot formation. Mol Genet Genomics 2006; 276(3): 242-53.
69
Tang W, Newton RJ, Li C, Charles TM. Enhanced stress tolerance in transgenic pine expressing the pepper CaPF1 gene is associated with the polyamine biosynthesis. Plant Cell Rep 2007; 26(1): 115-24.
70
Tang W, Newton RJ. Peroxidase and catalase activities are involved in direct adventitious shoot formation induced by thidiazuron in eastern white pine (Pinus strobus L.) zygotic embryos. Plant Physiol Biochem 2005; 43(8): 760-9.