Spring bread wheat Triticum aestivum cv. Saratovskaya 29 (M.A. Aitkhozhin Institute of Molecular Biology and Biochemistry, Almaty, Kazakhstan) was used for transformation. Plants were grown in the greenhouse with 16-hour light day conditions. Spikes were collected 14 days post-anthesis, and immature caryopses were sterilized by 70% ethanol (v/v) and 0.6% NaOCl with Tween 20, followed by rinsing three times with sterile water. Immature embryos were excised in a laminar flow under a stereoscopic microscope and placed on Murashige and Skoog medium [18] with centrophenoxine (4.43 g/l Murashige and Skoog basal medium with vitamins, 0.5 g/l casein acid hydrolysate, 40 ul/l cupric sulfate, 30 g/l sucrose, 30 mg/l centrophenoxine hydrochloride, 5 g/l Phytagel). Petri plates with excised embryos were kept in the dark at room temperature for 2-3 weeks with embryo-side in contact with the medium. Parts of resulting embryogenic calli were excised from the explants under a stereoscopic microscope and transferred to MS-based osmotic media (4.43 g/l Murashige and Skoog basal medium with vitamins, 0.5 g/l casein acid hydrolysate, 120 g/l sucrose, 40 ul/l cupric sulfate, 5 g/l Phytagel) prior to genetic transformation.

Class I chitinase gene was cloned in the Laboratory of Genome of M.A. Aitkhozhin Institute of Molecular Biology and Biochemistry. A full-size gene of 957 base pairs (bp) was inserted into a cloning vector by Rapid DNA Ligation Kit and multiplied in dam^-/dcm^- chemically competent E. coli cells. The presence of the insert was checked by plasmid DNA restriction with the XmnI enzyme. MEU – minimal expression unit – of 3,272 bp, consisting of maize ubiquitin promotor, chitinase gene, and terminator, was excised from the cloning vector by SpeI and XmaI restriction enzymes with its further dephosphorylation by SAP enzyme in accordance with manufacturer’s instructions. The fragment (MEU) was eluted from 1% agarose gel by GenElute Gel Extraction Kit (Sigma-Aldrich).

Minimal expression unit containing Acetohydroxyacid Synthase (AHAS) gene driven by ubiquitin promoter, which provided resistance to imidazolinone herbicides and was used for co-transformation, was courtesy of Australian Center for Plant Functional Genomics.

The biolistic transformation was carried out according to the protocol [19] using Biolistic Particle Delivery System PDS-1000/He (Bio-Rad). Embryogenic callus was incubated on osmotic media for not less than 4 hours. The minimal expression units of both chitinase and AHAS (100 ng each) were resuspended in 50 ul of gold particles with coating solution [19].

After particle bombardment, the calli were kept in the dark for 20-24 hours and then recovered on an MS-based recovery media (4.43 g/l Murashige and Skoog basal medium with vitamins, 0.5 g/l casein acid hydrolysate, 60 g/l sucrose, 40 ul/l cupric sulfate, 25 mg/l centrophenoxine hydrochloride, 5 g/l Phytagel). In one week, the calli were subcultured to MS selection media (4.43 g/l Murashige and Skoog basal medium with vitamins, 0.5 g/l casein acid hydrolysate, 30 g/l sucrose, 40 ul/l cupric sulfate, 25 mg/l centrophenoxine hydrochloride, 0.5 uM imazethapyr, 5 g/l Phytagel) and kept in the dark for two months at room temperature for further selection.

Calli that successfully underwent selection were transferred to regeneration medium (4.43 g/l Murashige and Skoog basal medium with vitamins, 0.5 g/l casein acid hydrolysate, 20 g/l maltose, 200 ul/l cupric sulfate, 1 mg/l kinetin, 5 mg/l zeatin, 5 g/l Phytagel) for shoot production and cultured in a 16-hour light period at 22-24°C for 2-4 weeks. Upon induction of shoots with two leaves, the cultures were transferred to rooting medium (2.2 g/l Murashige and Skoog basal medium with vitamins, 0.25 g/l casein acid hydrolysate, 25 ul/l cupric sulfate, 15 g/l sucrose, 0.25 uM imazethapyr, 4 g/l Phytagel) for the second round of selection. The resulting plantlets were transferred to soil and grown to maturity in the greenhouse conditions of 16-hour light period and 22-24°C.

For the identification of cisgenic plants, genomic DNA was extracted from the leaves of imazethapyr-resistant plants at the plantlets stage. Wheat DNA was extracted with Extract-N-Amp Red Plant PCR Kit (Sigma-Aldrich) following manufacturer’s instructions. Genomic DNA of non-transformed plants and water were both used as a negative control, while plasmid DNA was used as a positive control for the experiment. The cisgenic plants carrying chitinase target gene were identified by PCR using forward primer (5- ACCCTGTTGTTTGGTGTTACTTCTGC) and reverse primer (5- GCAGTAGCCCCAGGAGTAGG) with the following program: 96°C for 10 minutes, followed by 45 cycles of 1 min at 95°C, 1 min at 58°C, 1 min at 72°C, and 5 minutes extension at 72°C. The expected product of 529 bp in size was visualized by electrophoresis in 1.5% agarose gel stained by ethidium bromide.

The efficiency of transformation was calculated as the relation of regenerated plants with chitinase gene insert to the total number of calli in the experiment.

Preliminary work has been conducted for this study to find Kazakh wheat varieties best suitable for tissue culture, which resulted in the selection of six varieties for further work (data not shown). The variety of spring bread wheat Saratovskaya 29 showed the best qualitative characteristics in the process and was chosen as the main donor material. It is Kazakhstan’s classic original variety used in selection process for acquiring new wheat lines with improved qualities.

The plant material for embryogenic calli, grown in the controlled conditions in the greenhouse, served as a source of immature embryos used as explants (Fig. 1). A thorough selection of the original explant material allows less work at later stages when choosing material for biolistic experiments, saving time and labor used for processing the explants that have less chance to result in embryogenic callus. Therefore, the seeds were checked twice for the suitable developmental stage of the immature embryos: once in the greenhouse before the wheat head was cut and then controlled by a stereoscopic microscope when excising embryos in sterile conditions. Only the embryos with the correct size (2-3 mm) and developmental stage were cultured on the callus-inducing medium.

The same idea of thorough material selection was kept in mind when inducing callus – the time was optimized to achieve the maximum amount of embryogenic callus. One of the conventional approaches to cereal transformation is using calli from immature embryos obtained 2-7 days after callus induction [10, 20, 21]. In our work, we used embryogenic callus from longer cultivation. Partly, this longer period on the callus-inducing medium was caused by variety-specific peculiarities of Saratovskaya 29. On the other hand, the longer cultivation allowed a more precise screening of the material for further manipulations.

Fig. (1). Cell culture workflow of the experiment: a – immature embryos taken for embryogenic callus production, b – embryogenic calli selected for bombardment, c – transformed calli on regeneration media, d – regenerant plants on rooting media.

The chitinase gene used for the experiment was cloned from the Kazakhstan wheat variety Stepnaya 15 [22]. This variety is characterized by increased resistance to pathogens, hence making it a good source of resistance genes. The sequencing data of the cloned gene was aligned with similar sequences found in the international database to prove it is a Class I chitinase. The analysis of the alignment established 27 changes, 22 of which are synonymous, and 5 lead to changes in the amino acid sequence of the chitinase protein [23].

One of the objectives of the study was to use a cisgenic approach. Thus, the method of gene introduction into the wheat genome – biolistic transformation – was chosen to completely exclude unnecessary DNA sequences by using only Minimal Expression Units (MEU), as opposed to an agrobacterial transformation that might leave traces of the vector itself (T-DNA). Fig. (2) shows the vector used for amplification of the minimal expression unit used in the research.

The promoter chosen for constitutive expression of the target gene in wheat cells was the maize Ubiquitin Promoter (Ubi1), which has a good reputation in the stable transformation of cereals and is actively used for overexpression of target genes in wheat [6, 9, 10, 20].

Fig. (2). Vector constructs for wheat class I chitinase gene. The Minimal Expression Unit (MEU) is a sequence excised by SpeI and XmaI restriction enzymes, leaving only the promoter, gene of interest, and terminator parts of the construct for transformation.

For a further selection of the transformed regenerant plants, the chitinase minimal expression unit was co-transformed with another construct containing Acetohydroxyacid Synthase (AHAS) gene, providing tolerance to the imidazolinone herbicides. This gene is present in wheat and codes for the enzyme acetohydroxyacid synthase, which plays a leading role in the biosynthesis of branched-chain amino acids. There are three copies in wheat’s genome, one in each of A, B, and D genomes [24]. It is also present in fungi, bacteria, and all other plants and serves as a target to imidazolinone herbicides, which fill the substrate-access channel, thus inactivating the enzyme [25, 26]. The co-transformation strategy, instead of using one plasmid containing two genes, proved to be more effective and increases the transformation efficiency [27]. It is noteworthy that the integration is unlinked in this case, making it possible to select the progeny with only one target gene after possible segregation.

The AHAS gene was chosen to make the experiment cisgenic since, most often, selective markers used in wheat transformation are initially cloned from other organisms. One of the most popular genes used for selection is bar, conferring resistance to herbicide bialaphos [28]. Many studies involving resistance genes’ introduction into the genome of wheat used this gene [6, 9, 10, 29, 30]. Cisgenic approach to wheat transformation was used previously in the improvement of wheat baking qualities, and even in that case, only the target gene was cisgenic, while the selection marker – gene pmi – was bacterial [21].

The regenerant plants growing on selective media with herbicide imazethapyr and potentially carrying AHAS gene were checked for its presence. The PCR analysis showed that 58 out of 59 plants have the necessary band (524 bp, Fig. (3)), meaning that one plant was herbicide-tolerant due to other mechanisms.

Fig. (3). Wheat regenerants with AHAS construct as proved by PCR. M – molecular weight marker (1kb), 1 – positive control (plasmid DNA of the construct), 3-12 – experimental plants, 13 – negative control.

The regenerant plants were also checked for the presence of chitinase construct. When designing primers for analysis of the introduced target gene in cisgenic works, one should account for the genes with the same or similar nucleotide sequence in the object's genome. In this case, the chitinase genes are present in the wheat genome, so the specific primers were designed to amplify the area at the border of the Ubi1 promoter and chitinase coding sequence. Fig. (4) presents the PCR results; plasmid DNA with minimal expression unit served as a positive control.

As shown in the Fig. (4), the chitinase insert-positive plants have the necessary amplicon of 529 bp. The experimental plant in lane 8 does not have the needed band, meaning that this plant is free of the chitinase construct. The results of PCR analysis proved that 51 plants of T.aestivum cv. Saratovskaya 29 were successfully transformed with class I wheat chitinase.

Fig. (4). Wheat regenerants with chitinase minimal expression unit as proved by PCR. M – molecular weight marker (1kb), 1 – positive control, 3-13 – experimental plants.

Thus, 51 plants out of 59 regenerants were co-transformed with two genes, seven plants have only AHAS gene insert, and one plant is free of target sequences and probably escaped the selection due to other tolerance mechanisms or factors.

The given study involved four series of experiments with a total number of 2299 calli. The results of transformation efficiency for each experimental series are given in Table 1.

Average transformation efficiency was found to be 1.84%, with a maximum of 3.4% in the first series of experiments and a minimum of 0.3% in the third series.

Total co-transformation efficiency – 51 out of 58 plants carrying both of the inserts at the same time – reached 87.93%.